| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.202155 |
| Chromosome: | chromosome 1 |
| Location: | 5233109 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g036400 | SDR3 | Short-chain dehydrogenase/reductase; (1 of 1) 1.1.1.313 - Sulfoacetaldehyde reductase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCAAACCGCACTCCGCAGCCGCTTGCTGCA |
| Internal bar code: | ACGGGTGATAACCGACCATGTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 600 |
| LEAP-Seq percent confirming: | 99.6667 |
| LEAP-Seq n confirming: | 2093 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTTGGAACGGAGGAAACAAG |
| Suggested primer 2: | AGCAAGCAGAAGGTTCCAAA |