| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.202203 |
| Chromosome: | chromosome 3 |
| Location: | 4010784 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g172050 | TFB4,TF2H3 | TFIIH 34kDa subunit; (1 of 1) K03143 - transcription initiation factor TFIIH subunit 3 (TFIIH3, GTF2H3, TFB4) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACAAAGCGTGACGCCCGCCACGCGTTTATT |
| Internal bar code: | TGCGACGAAATTGAGCGGTAGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 242 |
| LEAP-Seq percent confirming: | 99.5984 |
| LEAP-Seq n confirming: | 992 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCCATTACAACTTCGGCTGT |
| Suggested primer 2: | AAGGGTGGTAGGGTGGTAGG |