Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.202216 |
Chromosome: | chromosome 13 |
Location: | 3196580 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre13.g585500 | HAP1 | (1 of 12) IPR000326 - Phosphatidic acid phosphatase type 2/haloperoxidase; Putative haloperoxidase | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGACAGTCCTAACAGGCACGTTCGGCACAT |
Internal bar code: | GGGTTATCAGTCGAGTAGATGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 414 |
LEAP-Seq percent confirming: | 99.6753 |
LEAP-Seq n confirming: | 1228 |
LEAP-Seq n nonconfirming: | 4 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CAGTTCAGGAGTCCGAGAGG |
Suggested primer 2: | CCACAAGCAGTCAAAGCAAA |