| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.202372 |
| Chromosome: | chromosome 13 |
| Location: | 767844 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g566850 | SOUL2 | (1 of 4) IPR006917//IPR011256 - SOUL haem-binding protein // Regulatory factor, effector binding domain; SOUL heme-binding protein | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGCACATATACACGGGGCCGCGCCACGGG |
| Internal bar code: | ACATCAGGACCTCCGCCCACCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 907 |
| LEAP-Seq percent confirming: | 98.1508 |
| LEAP-Seq n confirming: | 4087 |
| LEAP-Seq n nonconfirming: | 77 |
| LEAP-Seq n unique pos: | 27 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCCACATGCACACACATACA |
| Suggested primer 2: | TATCTTTTGCTCCCTCCCCT |