Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.202426 |
Chromosome: | chromosome 3 |
Location: | 4010784 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g172050 | TFB4,TF2H3 | TFIIH 34kDa subunit; (1 of 1) K03143 - transcription initiation factor TFIIH subunit 3 (TFIIH3, GTF2H3, TFB4) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACAAAGCGTGACGCCCGCCACGCGTTTATT |
Internal bar code: | GGTTGGTTGAAGCTTTGTTTAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 180 |
LEAP-Seq percent confirming: | 98.9041 |
LEAP-Seq n confirming: | 361 |
LEAP-Seq n nonconfirming: | 4 |
LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCCATTACAACTTCGGCTGT |
Suggested primer 2: | AAGGGTGGTAGGGTGGTAGG |