Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.202445 |
Chromosome: | chromosome 16 |
Location: | 6283977 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g674700 | AGH1 | ADP-ribosyl glycohydrolase; (1 of 1) 3.2.2.24 - ADP-ribosyl-[dinitrogen reductase] hydrolase / Dinitrogenase reductase activating glycohydrolase | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGAGGTTGGCGCATTTATCCACAGAGGGAA |
Internal bar code: | TGGCCGTCGAGGGTTTTTTAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 669 |
LEAP-Seq percent confirming: | 99.1162 |
LEAP-Seq n confirming: | 2355 |
LEAP-Seq n nonconfirming: | 21 |
LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTCCAGAAGCCGAACAAGAG |
Suggested primer 2: | GGAGTTTCTTCAGTGGCAGC |