| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.202644 |
| Chromosome: | chromosome 2 |
| Location: | 6597751 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g117250 | (1 of 5) 3.2.1.23 - Beta-galactosidase / Lactase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACATCCTGACCTGAAGATCACACCACACAT |
| Internal bar code: | GCACAGACCGGTAGAAGCCTAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 700 |
| LEAP-Seq percent confirming: | 98.9055 |
| LEAP-Seq n confirming: | 994 |
| LEAP-Seq n nonconfirming: | 11 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCAACTCCAGTGTCAGCCAG |
| Suggested primer 2: | TTCGCAGCAATAACAACAGC |