| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.202755 |
| Chromosome: | chromosome 12 |
| Location: | 3224731 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g498750 | LIP2,LIPG2 | (1 of 1) K14452 - gastric triacylglycerol lipase (LIPF); Putative triacylglycerol lipase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGCTAAGAAGACTGCACACTTAGCTTACG |
| Internal bar code: | CGTCCAACCCCATAGACGTAGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 141 |
| LEAP-Seq percent confirming: | 22.5935 |
| LEAP-Seq n confirming: | 284 |
| LEAP-Seq n nonconfirming: | 973 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTCTGCTAAGTGTGCCCTCC |
| Suggested primer 2: | CACGCACACACAGAGTTCCT |