| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.202786 |
| Chromosome: | chromosome 1 |
| Location: | 876306 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g004600 | RWP12 | (1 of 16) PF02042 - RWP-RK domain (RWP-RK); RWP-RK transcription factor | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGTGGTGGTGCGGTGCTGGCGGCATGTAC |
| Internal bar code: | GTAAGCGTCTGCCCCCCCGACT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 880 |
| LEAP-Seq percent confirming: | 82.7789 |
| LEAP-Seq n confirming: | 423 |
| LEAP-Seq n nonconfirming: | 88 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTCCTGCTGTTCACGTTCCT |
| Suggested primer 2: | AGAGAGCACAACGGGAGAAA |