| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.202805 |
| Chromosome: | chromosome 1 |
| Location: | 1643561 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g008650 | CDK1 | Cyclin-dependent kinase; (1 of 12) 2.7.11.22//2.7.11.23 - Cyclin-dependent kinase / Cdk-activating protein kinase // [RNA-polymerase]-subunit kinase / CTD kinase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGACGCGACTGCTCGTAAACACGACATCC |
| Internal bar code: | GTGCGATGACCTGGCTACAAAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 515 |
| LEAP-Seq percent confirming: | 99.8832 |
| LEAP-Seq n confirming: | 855 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTTCACGACTACCTCCTGCC |
| Suggested primer 2: | GACTGCAAAGCTTCCGTTTC |