| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.202980 |
| Chromosome: | chromosome 3 |
| Location: | 6038250 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g191200 | RME3 | (1 of 3) K06236 - collagen, type I/II/III/V/XI/XXIV/XXVII, alpha (COL1AS); RNA methylase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGCTCTAGACCAGTTGCAGGTTTCACTGG |
| Internal bar code: | ACGCAAACATCCCGCTCATGAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 622 |
| LEAP-Seq percent confirming: | 97.6 |
| LEAP-Seq n confirming: | 1708 |
| LEAP-Seq n nonconfirming: | 42 |
| LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGGATTAGTGTCCACACGCT |
| Suggested primer 2: | TTCGGCAGCTATGAGGACTT |