Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.203056 |
Chromosome: | chromosome 9 |
Location: | 1925578 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g395200 | (1 of 1) PF04087 - Domain of unknown function (DUF389) (DUF389) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAGAAGATGCGGCCCTGGGTCATTGACAGT |
Internal bar code: | CAGCAATCAGGGAGGTGGTTAT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 995 |
LEAP-Seq percent confirming: | 99.7601 |
LEAP-Seq n confirming: | 7486 |
LEAP-Seq n nonconfirming: | 18 |
LEAP-Seq n unique pos: | 46 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGGGTACAGGTGGAAAAGAA |
Suggested primer 2: | ACCTACTGCTTCACGCGACT |