| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.203112 |
| Chromosome: | chromosome 10 |
| Location: | 6510702 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g466650 | FAP252 | (1 of 1) PTHR10891:SF596 - SPERMATOGENESIS-ASSOCIATED PROTEIN 21; Flagellar Associated Protein 252 | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTTACGGAGCCGGAATGGAAGATTCCAGGG |
| Internal bar code: | GGACCGGTTCGGTCGAGAGCGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 289 |
| LEAP-Seq percent confirming: | 99.2095 |
| LEAP-Seq n confirming: | 502 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGCTACCGTATGGTGCAGTT |
| Suggested primer 2: | CAGCACAACTCACTCTCCCA |