| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.203118 |
| Chromosome: | chromosome 3 |
| Location: | 9115069 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g211521 | FAP165 | (1 of 1) IPR006015//IPR006016//IPR014729 - Universal stress protein A // UspA // Rossmann-like alpha/beta/alpha sandwich fold; Flagellar Associated Protein 165 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AATTTTACGAAGGTCCAGCAGCAGTGTGGA |
| Internal bar code: | GTCTAGTGTTGGCGCTGAATGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 818 |
| LEAP-Seq percent confirming: | 72.454 |
| LEAP-Seq n confirming: | 2675 |
| LEAP-Seq n nonconfirming: | 1017 |
| LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCACACACCTGCTCGTAGAA |
| Suggested primer 2: | CTGTGGGTGGTGAAGAAGGT |