Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.203158 |
Chromosome: | chromosome 2 |
Location: | 3769196 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g095400 | BRIX1 | Ribosome biogenesis protein; (1 of 1) K14820 - ribosome biogenesis protein BRX1 (BRX1, BRIX1) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAACTCCGTTGGCCCCGCCAGCTCGACCAC |
Internal bar code: | ACGATTAACTCTAGCCCCGCCT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 172 |
LEAP-Seq percent confirming: | 99.9392 |
LEAP-Seq n confirming: | 1643 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACAGATCTTTGCTGGCTCGT |
Suggested primer 2: | GGCAAGTCCTGGACAACATT |