| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.203222 |
| Chromosome: | chromosome 5 |
| Location: | 2610020 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g236250 | Conserved WD40-repeat Protein; (1 of 2) PTHR22847//PTHR22847:SF459 - WD40 REPEAT PROTEIN // SUBFAMILY NOT NAMED | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAGTCTGGTCGCCGCCATTGGACCCCTGTC |
| Internal bar code: | GGGTCCGCCTCCCGTCTGTGTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 372 |
| LEAP-Seq percent confirming: | 80.0635 |
| LEAP-Seq n confirming: | 2016 |
| LEAP-Seq n nonconfirming: | 502 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGATTGCACATACCTTGGGC |
| Suggested primer 2: | GACACATCCTGGACATGCAC |