| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.203405 |
| Chromosome: | chromosome 4 |
| Location: | 1244303 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g215150 | SSS1B,SSS1,SSIb | (1 of 1) IPR023159 - SO1590-like domain; Soluble starch synthase IB | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGTTTGATCGCCTGGTCCTTTGCCGGACCG |
| Internal bar code: | TCGTTGAATACGCGATTGAAGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 457 |
| LEAP-Seq percent confirming: | 99.6764 |
| LEAP-Seq n confirming: | 924 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAGTTTCGCAGTCACCAGAA |
| Suggested primer 2: | GATATAGGGCTGGGTGCAGA |