| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.203439 |
| Chromosome: | chromosome 4 |
| Location: | 1744737 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g212300 | PPP17 | (1 of 1) PTHR13832:SF224 - PROTEIN PHOSPHATASE 2C 70; Phosphoprotein phosphatase 2C-related | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCCAATATGCAGACGCCGCCACGGGCTTT |
| Internal bar code: | GAGTCGTTGGTCACTATGGGTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 231 |
| LEAP-Seq percent confirming: | 94.7368 |
| LEAP-Seq n confirming: | 36 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATGGCTCGGTACTCACAACC |
| Suggested primer 2: | TCTCGCAACACTTCTCGCTA |