Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.203452 |
Chromosome: | chromosome 8 |
Location: | 4824778 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre08.g384390 | POLQ2 | DNA polymerase theta; (1 of 2) K02349 - DNA polymerase theta [EC:2.7.7.7] (POLQ) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTCGCCGCCGCCCTCTCCCGCCGCCGCTG |
Internal bar code: | ATAGGGACATATCGGCGATGGGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 0 |
LEAP-Seq percent confirming: | 0.0 |
LEAP-Seq n confirming: | 0 |
LEAP-Seq n nonconfirming: | 38 |
LEAP-Seq n unique pos: | 0 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AAGGACTATGCAGTGCACCA |
Suggested primer 2: | TAGCAGCAAGTGGGTGTCTG |