Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.203473 |
Chromosome: | chromosome 5 |
Location: | 1651604 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre05.g243150 | Carbonic anhydrase-related protein; (1 of 1) PF04357 - Family of unknown function (DUF490) (DUF490) | 3'UTR_intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGGAGCGCGGCACGCGTGCCGCTTTTTCC |
Internal bar code: | TAAGTCTCGTTGCACTAGCCGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 105 |
LEAP-Seq percent confirming: | 98.9399 |
LEAP-Seq n confirming: | 1400 |
LEAP-Seq n nonconfirming: | 15 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GAATCCACCAACCTGCCTTA |
Suggested primer 2: | GCAACAGAGCCACCACAGTA |