| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.203489 |
| Chromosome: | chromosome 9 |
| Location: | 5276572 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g399738 | (1 of 239) IPR016024 - Armadillo-type fold | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGCGTCCATGCCAGGGCTGCGGGACCAGG |
| Internal bar code: | AAGACCGTTCCGCGGCGCGCTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 18 |
| LEAP-Seq percent confirming: | 99.726 |
| LEAP-Seq n confirming: | 1456 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCAGTGCATCATCTCAGCAT |
| Suggested primer 2: | TCAATGAGCATCTTGGTTGC |