Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.203573 |
Chromosome: | chromosome 6 |
Location: | 5594463 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g285650 | ORC6 | (1 of 1) PF05460 - Origin recognition complex subunit 6 (ORC6) (ORC6); Origin recognition complex subunit 6 | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAGCACCTACACTGCAACCTGAGTCGCAAC |
Internal bar code: | GAGTGGGAATCTGGTTTGGAAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 836 |
LEAP-Seq percent confirming: | 99.5772 |
LEAP-Seq n confirming: | 942 |
LEAP-Seq n nonconfirming: | 4 |
LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTAAGTCGGGGCAGATGTGT |
Suggested primer 2: | GCTCTCCTCCTCGCTCTTTT |