| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.203669 |
| Chromosome: | chromosome 16 |
| Location: | 1046216 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g649400 | RRM15,CPLD16 | Putative RNA methyl transferase; (1 of 1) PTHR11061:SF12 - RNA BINDING PROTEIN-RELATED | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCGTGTGCATTGCAAGGGGCCGCTGTAGG |
| Internal bar code: | CGACTTGGAACTAAATCTGGTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 170 |
| LEAP-Seq percent confirming: | 98.2695 |
| LEAP-Seq n confirming: | 795 |
| LEAP-Seq n nonconfirming: | 14 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TAGGTCCTCAACCTGGCATC |
| Suggested primer 2: | ACCACACACACACACACACG |