| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.203675 |
| Chromosome: | chromosome 1 |
| Location: | 2636724 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g015350 | POR1,POR | Light-dependent protochlorophyllide reductase; (1 of 1) K00218 - protochlorophyllide reductase (E1.3.1.33, por) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCTCGTGGGCGCGTGCTGGGGCTCGGGGA |
| Internal bar code: | GGGATCCTTGTGACCGCGACG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 606 |
| LEAP-Seq percent confirming: | 99.1863 |
| LEAP-Seq n confirming: | 1097 |
| LEAP-Seq n nonconfirming: | 9 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAAACACTGCGGACAATCCT |
| Suggested primer 2: | ACTCAATCCTGCACCTGGAC |