| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.203765 |
| Chromosome: | scaffold 19 |
| Location: | 102564 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre19.g750647 | (1 of 1) PF01636//PF07714 - Phosphotransferase enzyme family (APH) // Protein tyrosine kinase (Pkinase_Tyr) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCTCGTATTGCCAGCCAACCGGGGCCAGC |
| Internal bar code: | CTCTGCCAAGCTCGGGCGACTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 947 |
| LEAP-Seq percent confirming: | 97.7077 |
| LEAP-Seq n confirming: | 2046 |
| LEAP-Seq n nonconfirming: | 48 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTGCCTAAGCCATGTCCATT |
| Suggested primer 2: | AGCCATAGTTATGCATGGGC |