| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.203776 |
| Chromosome: | chromosome 1 |
| Location: | 1672254 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g008850 | HLM2 | (1 of 1) PF12931//PF12932 - Sec23-binding domain of Sec16 (Sec16_C) // Vesicle coat trafficking protein Sec16 mid-region (Sec16); Histone-lysine N-methyltransferase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTGAGCGGCCGCCGCCCGCCAGCAGCCGC |
| Internal bar code: | ATCATTTTCGGCCAGTGTAGCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 403 |
| LEAP-Seq percent confirming: | 97.9221 |
| LEAP-Seq n confirming: | 754 |
| LEAP-Seq n nonconfirming: | 16 |
| LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCATGCAGTCGGTGTCTAAA |
| Suggested primer 2: | AGCAGCAGCACCTGGTATG |