Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.203977 |
Chromosome: | chromosome 11 |
Location: | 3633148 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre11.g482200 | FBB9,FAP299 | (1 of 1) PF14713 - Domain of unknown function (DUF4464) (DUF4464); Flagellar Associated Protein 299 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGCCGCTCCTGCTAACTTTCCTTACCACT |
Internal bar code: | GTCAGCGTCCATACCCGGGTCA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 562 |
LEAP-Seq percent confirming: | 99.7856 |
LEAP-Seq n confirming: | 931 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGTGAATACCAGCCCAAACT |
Suggested primer 2: | GTTGTCCAGTTCCACACACG |