| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.204019 |
| Chromosome: | chromosome 17 |
| Location: | 3495054 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g725050 | UBL5 | (1 of 1) K13113 - ubiquitin-like protein 5 (UBL5, HUB1); Ubiquitin-related protein | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCTTGGAGCACCCCAGCCACCGTGCCACAG |
| Internal bar code: | GGATTGCACGAGGGGAGGGGCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 943 |
| LEAP-Seq percent confirming: | 90.9091 |
| LEAP-Seq n confirming: | 20 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAGATGGCAGGCAGTCTAGG |
| Suggested primer 2: | ACACGATTTCAACTCCCCAG |