| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.204111 |
| Chromosome: | chromosome 16 |
| Location: | 3468075 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g672397 | DIV174 | (1 of 3) K17499 - protein phosphatase 1G [EC:3.1.3.16] (PPM1G, PP2CG) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAGATGCACAACGGCCGCGACAAGCCTACT |
| Internal bar code: | ACTCTCGTGTGATACGGGAGCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 973 |
| LEAP-Seq percent confirming: | 98.9507 |
| LEAP-Seq n confirming: | 3489 |
| LEAP-Seq n nonconfirming: | 37 |
| LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTCATAGGACCCTCAGCAGC |
| Suggested primer 2: | TAACGCCAACCTCAACATCA |