| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.204267 |
| Chromosome: | chromosome 14 |
| Location: | 2011628 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g621600 | (1 of 1) PF15003 - HAUS augmin-like complex subunit 2 (HAUS2) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTAGGGCGCCTAGCGGTTTGTTGAGCGTTG |
| Internal bar code: | GGGCTTTTCCACTTCTTTGCTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 780 |
| LEAP-Seq percent confirming: | 99.8365 |
| LEAP-Seq n confirming: | 2442 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCAGAGAGCCCAGTTGAGAC |
| Suggested primer 2: | AAACGGCAGCAGAGTGTTCT |