Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.204307 |
Chromosome: | chromosome 12 |
Location: | 2582040 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g505250 | FAP288 | (1 of 3) PF13202//PF13499 - EF hand (EF-hand_5) // EF-hand domain pair (EF-hand_7); EF Hand Containing Flagellar Associated Protein 288 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AATGTATATTTGCACCACAGCCGGCACGTT |
Internal bar code: | GCATCATTTGCTACGATAGTAC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 590 |
LEAP-Seq percent confirming: | 99.6004 |
LEAP-Seq n confirming: | 8974 |
LEAP-Seq n nonconfirming: | 36 |
LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACGTCTGTACACCCGAAAGG |
Suggested primer 2: | AGGTTGGAGAACGGGATCTT |