| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.204312 |
| Chromosome: | chromosome 2 |
| Location: | 2445779 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g091700 | RIB72 | Flagellar protofilament ribbon protein 72; (1 of 1) PF06565//PF13499 - Repeat of unknown function (DUF1126) (DUF1126) // EF-hand domain pair (EF-hand_7) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAACAGAACAGTCATGCGCGCGTGCTGTCC |
| Internal bar code: | AGCCGGCGTGCAAGCTACTGAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1025 |
| LEAP-Seq percent confirming: | 99.6702 |
| LEAP-Seq n confirming: | 3627 |
| LEAP-Seq n nonconfirming: | 12 |
| LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCGTGAAACAGTGTCGTTTG |
| Suggested primer 2: | GCGCCAGAAGATTTACAAGC |