| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.204471 |
| Chromosome: | chromosome 12 |
| Location: | 3169607 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g499300 | PDE31 | (1 of 4) K13293 - cAMP-specific phosphodiesterase 4 (PDE4); 3'%252C5'-cyclic-nucleotide phosphodiesterase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCCAAGGAAGGCGGTTCCCCTTGGGGCCG |
| Internal bar code: | GTGTCAGTAGTAGGACGCCGCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 520 |
| LEAP-Seq percent confirming: | 81.134 |
| LEAP-Seq n confirming: | 3105 |
| LEAP-Seq n nonconfirming: | 722 |
| LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCCTAAACGCCCCTCTAAAC |
| Suggested primer 2: | GCACGACTGACTGTCTGCAT |