Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.204626 |
Chromosome: | chromosome 5 |
Location: | 3094862 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre05.g239050 | SMM15 | S-adenosyl-L-methionine-dependent methyltransferase; (1 of 1) K00599 - methyltransferase-like protein 6 (METTL6) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCTACGTGCGCGGCGACGGCACCCGCTGC |
Internal bar code: | AGGGGGTCACCGGGTGCCGGCG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 96 |
LEAP-Seq percent confirming: | 97.8723 |
LEAP-Seq n confirming: | 46 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCTCCAAACACACACACAGG |
Suggested primer 2: | CAATGGTGTGAGGTGAGGTG |