| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.204763 |
| Chromosome: | chromosome 9 |
| Location: | 2768923 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g389100 | GOT1 | (1 of 3) PF04178 - Got1/Sft2-like family (Got1); Got1, COPII vesicle component | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTTGCTAAGCACCGGCACCTTCCGCAGGAA |
| Internal bar code: | GCATGAGTCATCAGCAGGGCGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 954 |
| LEAP-Seq percent confirming: | 99.7572 |
| LEAP-Seq n confirming: | 2876 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCATTAGTTCCACATGCCCA |
| Suggested primer 2: | TGAGTCGCTTGAATTTGACG |