| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.204924 |
| Chromosome: | chromosome 11 |
| Location: | 3693419 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g482700 | (1 of 3) PF09011 - HMG-box domain (HMG_box_2) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCGAACTGATTTTCCGCTTTGCTGTGGGG |
| Internal bar code: | CACTCTCAGTTAGTTCAATCGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 659 |
| LEAP-Seq percent confirming: | 99.2941 |
| LEAP-Seq n confirming: | 5345 |
| LEAP-Seq n nonconfirming: | 38 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGGACTGAGGATGGAAAAGG |
| Suggested primer 2: | ATAGGCACCCTGCACAAAAC |