Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.205020 |
Chromosome: | chromosome 3 |
Location: | 5782317 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g188750 | HEL21 | (1 of 1) K13177 - ATP-dependent RNA helicase DDX1 [EC:3.6.4.13] (DDX1); DEAD/DEAH box helicase | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGCCGCTCTCCACGAAGTCGATCACGCGG |
Internal bar code: | GGACGCAAGCAAGAAACCGTCG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 147 |
LEAP-Seq percent confirming: | 99.3548 |
LEAP-Seq n confirming: | 154 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTTGCGAGCCAACATCACTA |
Suggested primer 2: | CGCGCTGTTTCTGTTTATGA |