Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.205314 |
Chromosome: | chromosome 10 |
Location: | 2987984 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g440750 | TOP3 | Topoisomerase type III, organellar DNA gyrase; (1 of 1) K02470 - DNA gyrase subunit B [EC:5.99.1.3] (gyrB) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAGTCCTGTTGCTTCACGCCGCGCGCATGC |
Internal bar code: | GGGGAGCCTCGTCAGGCGCCGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 885 |
LEAP-Seq percent confirming: | 99.9108 |
LEAP-Seq n confirming: | 3361 |
LEAP-Seq n nonconfirming: | 3 |
LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CAACATGATGTATCCCGCAA |
Suggested primer 2: | AGCACTTCTGTGTGCAGGTG |