| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.205369 |
| Chromosome: | chromosome 7 |
| Location: | 5205318 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g348650 | CYG65 | (1 of 11) 4.6.1.1//4.6.1.2 - Adenylate cyclase / ATP pyrophosphate-lyase // Guanylate cyclase / Guanylyl cyclase; Adenylate/guanylate cyclase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTAGAAACGGAGGTGCGCAGCTGCCGCAG |
| Internal bar code: | GGTGGCCTCGGCAGTGTGATG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 584 |
| LEAP-Seq percent confirming: | 99.0584 |
| LEAP-Seq n confirming: | 2630 |
| LEAP-Seq n nonconfirming: | 25 |
| LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCATGTGTGGATGTGTGTCA |
| Suggested primer 2: | GTGATTCGCGGTGGTCTTAT |