| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.205392 |
| Chromosome: | chromosome 12 |
| Location: | 4386507 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g520500 | RPLP0,RPP0 | Acidic ribosomal protein P0, Ribosomal protein L10; (1 of 1) K02941 - large subunit ribosomal protein LP0 (RP-LP0, RPLP0) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGAGCTGTGCCCTTCGTCCTCAGTCTCCC |
| Internal bar code: | TAGTTAGATCACAATAGGGCAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 420 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 75 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 18 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGTGGAGACCGACTACACCT |
| Suggested primer 2: | GACAAGAGCGGAAGTTCGAC |