| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.205404 |
| Chromosome: | chromosome 3 |
| Location: | 4885171 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g179350 | MFT16 | Major facilitator superfamily transporter; (1 of 1) PF03825//PF07690 - Nucleoside H+ symporter (Nuc_H_symport) // Major Facilitator Superfamily (MFS_1) | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCGATAGCGGATCGGCAGGAATTGCGGGCC |
| Internal bar code: | ACACGGCGAGCATGTAACTGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 689 |
| LEAP-Seq percent confirming: | 98.9171 |
| LEAP-Seq n confirming: | 2649 |
| LEAP-Seq n nonconfirming: | 29 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAGTGGGGTTTGGGGTAAAG |
| Suggested primer 2: | ACCATTATGCGGTTTGGGTA |