| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.205420 |
| Chromosome: | chromosome 4 |
| Location: | 4052811 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g232802 | (1 of 70) 3.1.3.16 - Protein-serine/threonine phosphatase / Serine/threonine specific protein phosphatase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACAATCAAAGCAAAAGCTTTCACCATCGAG |
| Internal bar code: | ACATTAGAGGGCGGAACTCCGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1013 |
| LEAP-Seq percent confirming: | 99.5295 |
| LEAP-Seq n confirming: | 2750 |
| LEAP-Seq n nonconfirming: | 13 |
| LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCTATATTTCGCCCACAGCC |
| Suggested primer 2: | ACTGGTGTGGTAGTGAGGGC |