| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.205463 |
| Chromosome: | chromosome 12 |
| Location: | 8861559 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g544750 | (1 of 1) PF13637//PF13857 - Ankyrin repeats (many copies) (Ank_4) // Ankyrin repeats (many copies) (Ank_5) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAAGGAGGCCGGGCGGCTGGTGCCCTCTCA |
| Internal bar code: | GTCCCGTCGTTTGGCCCAGGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 328 |
| LEAP-Seq percent confirming: | 99.4516 |
| LEAP-Seq n confirming: | 1088 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CATTTTTATTTGGGGGAGGG |
| Suggested primer 2: | GCAGGAGCAAATCTTTCAGG |