Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.205473 |
Chromosome: | chromosome 12 |
Location: | 3065167 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g500450 | TPD1 | (1 of 2) PTHR12121:SF37 - 2',5'-PHOSPHODIESTERASE 12; 2'%252C5'-phosphodiesterase | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTGGTGTAGACGCACGTGTCCCTGCAGGG |
Internal bar code: | AGGTTTTGCAAATAGTTTGCCC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 237 |
LEAP-Seq percent confirming: | 99.6819 |
LEAP-Seq n confirming: | 940 |
LEAP-Seq n nonconfirming: | 3 |
LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TACACCAGGGTGAGGAGGAC |
Suggested primer 2: | TTTGTGTGTGTGTGTGTGGG |