| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.205533 |
| Chromosome: | chromosome 6 |
| Location: | 3834285 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g278170 | FAP237,FAS7,FAS16,FLA11 | Flagellar Associated Protein 237; (1 of 1) PTHR10900:SF77 - PROTEIN F26E4.7, ISOFORM A | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATCGCATACTTGCACTTGCCTATTGAGGTT |
| Internal bar code: | GCGGTGCCTCGTCACCCTCGTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 846 |
| LEAP-Seq percent confirming: | 99.5741 |
| LEAP-Seq n confirming: | 3507 |
| LEAP-Seq n nonconfirming: | 15 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTGCGGTCAACGATTAATGA |
| Suggested primer 2: | CATCTGCGAAGCATTTACGA |