| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.205539 |
| Chromosome: | chromosome 4 |
| Location: | 2112044 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g219450 | DNJ30:MIDFRAG | (1 of 1) 1.3.1.21 - 7-dehydrocholesterol reductase / Sterol Delta(7)-reductase; Rieske [2Fe-2S] domain protein | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATTTCTTGGGAAAGCAAATCACGAAAGGAG |
| Internal bar code: | TCGACAGGGGGCAAGTGTTGCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 644 |
| LEAP-Seq percent confirming: | 99.8042 |
| LEAP-Seq n confirming: | 1529 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAATAACCGCAACAGCAACC |
| Suggested primer 2: | AACTGCATGGTTGTATGCCA |