| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.205563 |
| Chromosome: | chromosome 14 |
| Location: | 384978 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g610501 | RAA14,SDR34 | (1 of 2) IPR002347//IPR003560 - Glucose/ribitol dehydrogenase // 2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase; Short-chain dehydrogenase/reductase found in psaA trans-splicing complex | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTAATTTTGCTGCCACACCCCATCAATACC |
| Internal bar code: | AGGTCTGCGATCCTTTTCCTGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 205 |
| LEAP-Seq percent confirming: | 98.9161 |
| LEAP-Seq n confirming: | 2099 |
| LEAP-Seq n nonconfirming: | 23 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTAGGAGGTGAGGGAGGAGG |
| Suggested primer 2: | CACCGGAGTTTTCGTTGAAT |