| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.205595 |
| Chromosome: | chromosome 6 |
| Location: | 3354773 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g277650 | BES4 | (1 of 10) PF01062 - Bestrophin, RFP-TM, chloride channel (Bestrophin); putative chloride channel | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTTGCCGCTGGAGAACTTCTGTGACGCCG |
| Internal bar code: | CTTTCCAAGATATTCTAGTTAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 680 |
| LEAP-Seq percent confirming: | 99.5904 |
| LEAP-Seq n confirming: | 1702 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TAGCAAAATTTCATGCAGCG |
| Suggested primer 2: | ACACAAACGCATGTTTGGAA |