| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.205609 |
| Chromosome: | chromosome 3 |
| Location: | 8707340 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g204465 | GT90F36,GT90-36 | GT90 family protein 36; (1 of 52) PF05686 - Glycosyl transferase family 90 (Glyco_transf_90) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGCCGGATCCGTCACACACCCTGCTGGCG |
| Internal bar code: | TTTATCCATATGTGAGTACAGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 197 |
| LEAP-Seq percent confirming: | 99.781 |
| LEAP-Seq n confirming: | 2278 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CATTTTGGCCGTTTCCTAGA |
| Suggested primer 2: | CCTGCCTTGTCTAATCCCAA |