| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.205612 |
| Chromosome: | chromosome 6 |
| Location: | 2620426 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g269752 | TRXm,TRXM1,TRX15 | (1 of 1) IPR000104//IPR005746//IPR012336//IPR013766 - Antifreeze protein, type I // Thioredoxin // Thioredoxin-like fold // Thioredoxin domain; Thioredoxin m, chloroplastic | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCAGCTTCGCGCCGCTTCGGTCGGTTGCT |
| Internal bar code: | CAGAACGTCTCTCATGGTAGCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 153 |
| LEAP-Seq percent confirming: | 99.8058 |
| LEAP-Seq n confirming: | 1028 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAACAAGGGAAGGGAGAGGA |
| Suggested primer 2: | TGTTGGTAGCTGAGGCACTG |